?

Log in

No account? Create an account

ВИЧ и СПИД – жизнь и диагноз

личные заметки на заданную тему

Previous Entry Share Next Entry
FAQ для СПИД-диссидентов
СПИД, HIV, ВИЧ, AIDS
myhiv
Я уже не раз говорил о том, что перестал вступать в диссидентские споры по причине полной непродуктивности подобных дискуссий. Не смотря на все доводы, каждый остается при своем мнении, т.к. для меня все доводы диссидентов давно не новы и я их все знаю, а для подавляющего большинства диссидентов важна не правда о ВИЧ и СПИДе, а та нелепая теория заговора, которая им так нравится. Другая причина в том, что я все-таки не врач и не ученый, и поэтому моим ответам недоставало научной структурности, точности и ссылок на соответствующие работы, которые необходимы для подтверждения любых научных фактов.

После нелепой передачи Гордона на тему СПИДа, диссидентские страсти разгорелись с новой силой, но у всей этой шумихи неожиданно нашлась одна положительная сторона. Этот шум привлек внимание специалистов, которые обычно в подобные дискуссии не вступают по той же причине, по которой, к примеру, географы или космонавты не вступают в дискуссии на тему "Земля - плоская". Для них форма Земли не вопрос обсуждения, т.к. их каждодневная профессиональная деятельность связана с тем, что Земля имеет вполне определенную форму - форму шара.

Я решил сделать компиляцию всех найденных мною ответов специалистов на доводы диссидентов, которые, как мне кажется, охватывают если не все эти доводы, то очень большую их часть. Я прощу прощения у авторов всех этих ответов за не указание их имени, но вся эта информация попала ко мне уже в таком "обезличенном" виде.


Q: Где можно увидеть документы или доказательства тому, что ВИЧ вызывает СПИД?

A: Например, на шимпанзе проводили опыты и показали, что заражение определенными штаммами ВИЧ (не все штаммы ВИЧ-1 человека патогенны для шимпанзе) вызывают гибель лимфоцитов. Вот одна из относительно ранних работ в этой области.

Loss of CD4+ T Cells in Human Immunodeficiency Virus Type 1-Infected Chimpanzees Is Associated with Increased Lymphocyte Apoptosis. Ian C. Davis,1 Marc Girard,2 and Patricia N. Fultz3. J Virol. 1998 June; 72(6): 46234632.



Q: Почему, несмотря на огромные финансовые вливания ученые не продвинулись в своей теории ни на шаг?

A: Это ложное утверждение. Первые антиретровирусные препараты продлевали время до наступления СПИД всего на пару лет. Современные средства терапии позволяют отсрочить появление СПИД у ВИЧ+ людей на десятки лет. Это довольно серьезное продвижение. Так же установлен механизм проникновения вируса в клетки, в частном случае, роль рецепторов к цитокинам на поверхности лимфоцитов, с которыми вирус связывается. Есть первый случай полного выздоровления ВИЧ+ больного в германии. К сожалению, примененная процедура лечения сама по себе очень опасна и сложна, поэтому утверждать, что лекарство найдено нельзя. Больному раком c ВИЧ сделали пересадку костного мозга, а донором взяли человека с мутацией CCR5_delta_32, защищающей лимфоциты от ВИЧ. Есть все основания полагать, что этот человек вылечился и от рака и от ВИЧ.



Q: Тест на антитела совершенно не специфичен. Зафиксировано около 60 различных факторов влияющих на результаты тестов.

A: Подтверждение: Журнал Континуум, созданный с целью ознакомления медицинской общественности с альтернативными мнениями, в своих материалах представил список факторов, вызывающих ошибочные положительные результаты теста на ВИЧ-антитела. (Сентябрь,1996, Зенгерс, Калифорния) Описанный перечень не достоверен, ибо ни одно из состояний НЕ ГАРАНТИРУЕТ положительного результата ИФА, а значит, не может являться показателем, что оно действительно является приличной ложноположительного результата.



Q: Какой метод дает точный ответ о наличии ВИЧ?

A: Меньше всего ложноположительных результатов даст метод, сочетающий выделение РНК из крови, обратную транскрипцию РНК в ДНК, ПЦР с использованием полученной ДНК в качестве матрицы и последующее клонированием, плюс чтение образца на секвенаторе. Если описывать подробнее, то это выглядит так. ВИЧ имеет геном, представляющий из себя двойную цепочку РНК. Выделяем РНК из крови пациента, РНК превращаем в ДНК с помощью фермента «обртаной транскриптазы» (кстати, у ВИЧ есть такой фермент), ДНК размножаем в пробирке (ПЦР), вставляем в вектор (бактериальную плазмиду), размножаем вектор в культуре бактерий, выделяем вектор со вставкой, читаем последовательность вставки (пару сотен нуклеотидов) и мы точно знаем не только есть ли ВИЧ в крови, но и всевозможные детали, вроде штамма вируса, наличие мутаций в его геноме и т.д. Такая процедура занимает довольно много времени и относительно дорога, поэтому массово не используется. Но если пациент захочет такую процедуру то, как говорится, всегда пожалуйста.

В целом есть серия довольно надежных методов, обладающих высокой специфичностью и чувствительностью (~99%). Можно проверить наличие антител к белкам вирусной оболочки. Можно сделать просто ПЦР, без секвенирования.



Q: Почему СПИД бывает у тех, у кого нет ВИЧ?

A: ВИЧ и СПИД не синонимы. СПИД понятие более широкое и означает дефицит иммунитета. Такое состояние может возникнуть в результате самых различных причин: при хронических истощающих заболеваниях, воздействии лучевой энергии, у детей с дефектами иммунной системы и у больных старческого возраста с инволюцией иммунной защиты, некоторых медикаментозных и гормональных препаратов. ВИЧ-инфекция - прогрессирующее антропонозное инфекционное заболевание, с кровоконтактным механизмом заражения, характеризующееся специфическим поражением иммунной системы с развитием тяжелого иммунодефицита, который проявляется вторичными инфекциями, злокачественными новообразованиями и аутоиммунными процессами.
Болезнь передается при половых контактах, особенно гомосексуальных; от инфицированной матери к ребенку в период беременности через плаценту, во время родов, при грудном вскармливании от матери к плоду; через бритвенные приборы и другие колюще-режущие предметы, зубные щетки и т. п. Эпидемиологи ВИЧ не допускают существования воздушно-капельного и фекально-орального путей передачи, так как выделение ВИЧ с мокротой, мочой и калом весьма незначительно, а также незначительно и число восприимчивых клеток в желудочно-кишечном тракте и дыхательных путях.



Q: Даже по официальным данным риск передачи ВИЧ половым путем меньше 0,01%. То есть чтобы заразиться ВИЧ половым путем, нужно вступать в незащищенные контакты с ВИЧ+ 10 000 раз. Значит, передача невозможна.

A: Подсчет в корне неверен. Данная вероятность говорит, что в случае 10 000 ВИЧ+ людей, имеющих одномоментно секс с 10 000 ВИЧ- людей, один из этих 10 000 ВИЧ- людей заразится.



Q: Откуда взяли данные о том, какие белки входят в ВИЧ?

A: Во-первых, прочитан геном вируса, поэтому известны последовательности генов, входящих в состав вирусного генома, а значит и аминокислотная последовательность вирусных белков.

Во-вторых, есть более сложные, но действующие методы прямого чтения аминокислотных последовательностей, одним из которых является масс спектрометрия.

В-третьих, есть рентген-структурный анализ, позволяющий определить структуру белков. Чтобы подсмотреть структуры белков вируса ВИЧ, можно зайти в базу данных pdb.

В-четвертых, гены всех белков ВИЧ так или иначе были клонированы, а функции белков неоднократно исследовались в экспериментальных условиях. Т.е. мы не только знаем, какие белки входят в состав ВИЧ, но и ряд их функций.



Q: ВААРТ - это химия, которая убивает человека быстрее, чем любая существующая болезнь.
http://www.natap.org/2006/HIV/011906_01.htm

A: Думаю, исследование тут переводить не имеет смысла. Хотя, если кому-то будет интересно, могу заняться. Кратенько исследование показывает увеличение продолжительности жизни и снижение смертности от различных причин на АРВТ.



Q: При ПЦР обнаруживают определенные нуклеотидные последовательности (например, env или gag), почему-то считающиеся специфическими для ВИЧ, хотя это вовсе не так. Последовательности env и gag имеется в человеческих ретротранспозонах, т.е. в нашем собственном геноме. Осмелюсь утверждать, что отличить наш собственный gag от вирусного невозможно.

A: gag бывают разные. ВИЧ-1 имеет геном из более 9500 нуклеотидов, это уникальная последовательность. Известно, что она присутствует в качестве одного фрагмента.
Итак, берем последовательность gag ВИЧ-1 человека, выделенный в России (это не важно откуда, т.к. разница не большая).
Вот эта последовательность. Тут так же указаны все идентификаторы, чтобы любой мог проверить, что это та самая последовательность, что я не написал ее из головы.

gi|294992893|gb|GU991883.1| HIV-1 isolate Pat22 from Russia gag protein (gag) gene, complete cds; and pol protein (pol) gene, partial cds
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGCCAAATGGGAGAAAATTCGGTTGNGGCCAG
GAGGAAGAAACCAATATAAAATGAAACATTTAGTATGGGCAAGCAGGGAGATGGAGAGATTTGCACTTAA
CCCTGGCCTTATGGAAACAGCAGAAGGTTGTCAACAAATAATGGTACAGATACAACCAGCTCTCAAGACA
GGAACAGAGGAGCTTAGATCATTATATAATACAATAGCAGTTCTCTATTGTGTACACCAAAGGATAGAGA
TAAAAGACACCAAAGAAGCTCTAGAGGAAATAGAAAAGCTACAAAAGAAAAGTCAGCAAAAAACACAGCA
GGCAGCAACAGATACAGGAAACAGTAGCCAAGTCAGCCAAAATTATCCTATAGTGCAGAATGCACAAGGG
CAAATGGTACACCAGGCCATATCACCTAGGACCTTGAATGCATGGGTAAAAGTAGTAGAAGAAAAGTCCT
TTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAGGATTTGAATACCAT
GCTAAACACAGTGGGGGGGCATCAAGCAGCTATGCAGATGCTAAAGGAGGCTATCAATGATGAAGCTGCA
GAGTGGGACAGGTTACACCCACCACAGGCAGGGCCTATTGCGCCAGGCCAGATAAGAGAACCAAGGGGAA
GTGATATAGCAGGAGCTACTAGTACCCTGCAGGAGCAAATAACATGGATGACCAGCAACCCACCTATCCC
AGTGGGAGAAATTTATAAAAGATGGATAATCTTGGGATTAAATAGAATAGTAAGAATGTATAGCCCTGTC
AGCATTTTAGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGATTATGTAGATAGGTTCTTTAAAACTT
TAAGAGCTGAGCAAGCTACACAGGAAGTAAAAAGCTGGATGACAGACACCTTGTTGRTCCAAAATGCGAA
CCCAGATTGTAAGAACATCTTAAGAGCATTAGGACCAGGAGCTTCACTAGAAGAAATGATGACAGCATGT
CAGGGAGTGGGAGGACCCAGCCATAAAGCAAGAGTTTTAGCTGAAGCAATGAGCCAGGCATCAGGTGCCG
CAGCGGCCATAATGATGCAGAAAAGCAATTTTAAGGGCCCAAGAAGAGCTATTAAGTGTTTCAACTGTGG
CAAGGATGGACATATAGCCAGAAATTGCAGGGCCCCTAGAAAGAAGGGCTGTTGGAAATGTGGAAAGGAG
GGACATCAAATGAAAGATTGCACRGAGAGCAAGGCTCATTTTTTAGGGAAAATCTGGCCCTCCAGCAGGG
AGAGGCCAGGGAATTTTCTTCAGAACAGGACAGAGCCAACAGCCCCACCAGCAGAGAGCTTCGGGGAGGA
GATAGCCCCTGCCCCGAAACAGGAGCCGAAGAAGGAGGAGCTATATCCCTTAGCCTCCCTCAAATCACTC
TTTGGCAGCGACCCYTAGTCTCAGTAAGAGTRGGGGGACAGCTAATAGAAGCYCTATTAGACACAGGAGC
AGATGATACAGTATTAGAAGACATAAATTTACCAGGAAAATGGAARCCAAAAATGATAGGGGGAATTGGA
GGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTTGTGGAAAAAAGGCTATAGGGACAG
TATTAGTAGGACCTACACCTATCAACATAATTGGGAGAAATATGTTGACTCAGATTGGYTGTACTTTAAA
TTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAMATTAAAGCCAGGAATGGATGGGCCAAAGATCAAA
CAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGAA
AAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAATATTTGCTATAAAGAAAAAAGACAGTAC
TAAATGGAGAAAATTAGTAGATTTCAGAGAGCTCAATAAAAGAACTCAAGACTTCTGGGAGGTACAATTA
GGAATACCTCACCCAGCAGGGTTAAAACAGAAAAAATCAGTAACAGTACTAGATGTGGGGGATGCATATT
TTTCAGTTCCATTAGATGAAAGCTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGARAC
ACCAGGAATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGT
AGCATGACAAAAATCTTAGAGCCCTTTAGAAARAGAAAYCCAGAAATGGTGATCTACCAATACATGGATG
ATTTATATGTGGGATCTGACTTAGAATTAGGACAACATAGAGCAAAAATAGAAGAGTTAAGAGAGCATTT
ACTGARATGGGGATTTACCACACCAGATAARAARCATCAGAAAGAACCTCCATTCTTRTGGATGGGATAT
GAGCTCCATCCTGACAARTGGACGGTACAACCTATACAGTTGCCAGATAAAGARAGCTGGACTGTCAATG
ATATACAAAAGCTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATCCAGGAATTAGAATAAGGCAACT
ATGTAAACTCATTAGGGGGGCTAAAGCACTAACAGACATAGTACCACTAACARAAGAAGCAGAGCTAGCA
CTA

Итак, кидаем эту последовательность в программ BLast против генома человека. Программа Blast ищет похожие последовательности. Это стандартная программ для поиска гомологичных (т.е. похожих) генетических последовательностей.
Вывожу результат работы программы:

Description
human build 37 genome database (reference GRCh37 and alternate assemblies) Program
BLASTN 2.2.23+
No significant similarity found.

Это означает, что в геноме человека, ни в одной известной сборке, такого гена нет. Даже близко нет, потому что даже если бы он был хоть чуть-чуть родственным, он бы нашелся. Более того, этого гена нет ни в одном известном геноме млекопитающего. Я это тоже проверил. Зато против вирусных последовательностей находится прекрасно. Кстати, этот фрагмент взят из генома вируса ВЫДЕЛЕННОГО в России ВИЧ-1. Вот работа Knops,E., Daeumer,M., Awerkiew,S., Kartashev,V., Schuelter,E., Kutsev,S., Brakier-Gingras,L., Kaiser,R., Pfister,H. and Verheyen,J. "Evolution of PI resistance in the gag and pol gene of HIV subtype G isolates" (работы сделана в Institute of Virology, University of Cologne)

Это воспроизводимая процедура, которую может проделать любой и убедиться, что товарищи Вам наглым образом соврали. Последовательности gag вируса иммунодефицита человека в геноме человека не обнаружено.

Где его можно обнаружить, так это в ДНК лимфоцита ВИЧ инфицированного. Ну может еще в паре типов клеток, у которых эксперссированы нужные рецепторы цитокинов и CD4. Все-таки это ретровирус и он может по определению выстроиться в геном, чтобы размножаться.

Если речь идет о других вирусных изолятах, то данный изолят российского вируса похож больше всего на изолят вируса из кубы
HIV-1 isolate Cu87 from Cuba, complete genome.
Это вирус был изолирован в 2007 в ходе следующей работы:
J Acquir Immune Defic Syndr. 2007 Jun 1;45(2):151-60.
Identification of 3 phylogenetically related HIV-1 BG intersubtype circulating recombinant forms in Cuba.
Sierra M, Thomson MM, Posada D, Pérez L, Aragonés C, González Z, Pérez J, Casado G, Nájera R.

Желающие могут использовать Blast указанной последовательности и ознакомиться с несколькими тысячами прочитанных генов других изолированных вирусов ВИЧ, посмотреть, чем они отличаются и так далее.

Если мы можем отличить ВИЧ кубинский от ВИЧ русского, неужели кто-то думает, что мы не отличим ВИЧ от гена человека?



Q: Есть вероятность, что ПЦР-тест находит собственные человеческие ретротранспозоны.
Transposons are mobile genetic elements that can multiply in the genome using a variety of mechanisms. Retrotransposons replicate through reverse transcription of their RNA and integration of the resulting cDNA into another locus. This mechanism of replication is shared with retroviruses, with the difference that retrotransposons do not form infectious particles that leave the cell to infect other cells. The long terminal repeat (LTR) retrotransposons, one of the main groups of retroelements (which include both LTR and non-LTR retrotransposons as well as retroviruses), are among the most abundant constituents of eukaryotic genomes. The LTRs are the direct sequence repeats that flank the internal coding region, which - in all autonomous (functional) LTR retrotransposons - includes genes encoding both structural and enzymatic proteins. The gag gene encodes structural proteins that form the virus-like particle (VLP), inside which reverse transcription takes place.
genomebiology.com/2004/5/6/225

Для тех, кто не знает, что такое ретротранспозоны, tсли совсем грубо это элементы ДНК, способные перемещаться, встраиваться и самовоспроизводиться.

A: И Вы сами же процитировали очень интересную вещь, которая стоит выделения:
This mechanism of replication is shared with retroviruses, with the difference that retrotransposons do not form infectious particles that leave the cell to infect other cells.

Ретротранспозоны НЕ ФОРМИРУЮТ инфекционных частиц, заражающих другие клетки. Они в принципе не покидают клеток. В микроскоп мы видим вирионы ВИЧ, покинувшие клетки. Их нельзя спутать с ретротранспозонами.




Q: Например, белок p24, считающийся специфичным для ВИЧ, используют как маркер в диагностике рака молочной железы.

A: Интересно, а с чего Вы взяли, что у протеина злокачественных клеток молочной железы и капсидного белка ВИЧ есть что-то общее, кроме молекулярной массы 24 кДа? Или два человека с одинаковым весом для Вас - это одно и тоже? p24 - белок массой 24 кДа. Вот и все. Любой белок массой 24 кДа может так называться. Это не таксономическое название. ВИЧ имеет HIV Gag p24.



Q: Каким образом геном вируса отделили от хозяйского генома и доказали, что это разные сущности?

A: Nature. 1985 Jan 24-30;313(6000):277-84. Complete nucleotide sequence of the AIDS virus, HTLV-III. Ratner L, Haseltine W, Patarca R, Livak KJ, Starcich B, Josephs SF, Doran ER, Rafalski JA, Whitehorn EA, Baumeister K, et al.




Q: Более чем за 6 лет наблюдений за парами не было зафиксировано ни одного случая передачи ВИЧ от позитивного партнёра к отрицательному. В качестве подтверждения - выдержка из исследования Нэнси Падиан. *We followed 175 HIV-discordant couples over time, for a total of approximately 282 couple-years of follow-up...The longest duration of follow-up was 12 visits (6 years). We observed no seroconversions after entry into the study...only 75% reported consistent condom use in the 6 months prior to their final follow-up visit. Forty-seven couples who remained in follow-up for 3 months to 6 years used condoms intermittently, and no seroconversions occurred among exposed partners.* Padian NS et al. Heterosexual Transmission of Human Immunodeficiency Virus (HIV) in Northern California: Results from a Ten-Year Study. Am J Epidemiol. 1997 Aug;146(4):350-7

Смысл содержания: Наблюдения за 175 парами, 75% из которых использовали презерватив нерегулярно, а 25% не использовали совсем, не показало установленных случаев заражения отрицательного партнера.

A: Во-первых, сама Нэнси Падиан откомментировала свои исследования так:
HIV is unquestionably transmitted through heterosexual intercourse. Indeed, heterosexual intercourse is now responsible for 70-80% of all HIV transmissions worldwide (2). The current likelihood of male to female infection after a single exposure to HIV is 0.01-0.32% (2, 3), and the current likelihood of female to male infection after a single exposure is 0.01-0.1% (2). In short, the evidence for the sexual transmission of HIV is well documented, conclusive, and based on the standard, uncontroversial methods and practices of medical science. Individuals who cite the 1997 Padian et al. publication (1) or data from other studies by our research group in an attempt to substantiate the myth that HIV is not transmitted sexually are ill informed, at best. Their misuse of these results is misleading, irresponsible, and potentially injurious to the public.

Полный текст тут: http://aidstruth.org/denialism/misuse/padian

Смысл высказывания: множеством исследований зарегистрирована передача половым путем и вышеприведенное исследование нельзя считать нерушимым доказательством отсутствия половой передачи ВИЧ, а все, кто использует эти данные в таком ключе - нехорошие люди.

Во-вторых, альтернативные данные:

КЛИНИКО-ИММУНОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА КОГОРТЫ ВИЧ-ИНФИЦИРОВАННЫХ И ГРУПП РИСКА ЗАРАЖЕНИЯ ВИЧ

Работа выполнена в Федеральном государственном бюджетном учреждении «Государственный научный центр «Институт иммунологии» Федерального медико-биологического агентства и Государственном учреждении здравоохранения Московской области Московском областном центре по профилактике и борьбе со СПИДом и инфекционными заболеваниями.

Среди 1711 обследованных гетеросексуальных половых партнеров ВИЧ-инфицированных ВИЧ-инфекция была выявлена у 300, показатель заболеваемости составил 17,5%. При этом из 708 обследованных партнеров ВИЧ-инфицированных по совместному употреблению инъекционных наркотиков, ВИЧ-инфекция была выявлена у 88, показатель заболеваемости составил 12,4%. Это подтверждает, что половые контакты являются существенным фактором распространения ВИЧ-инфекции в Московской области.

С развитием эпидемии ВИЧ-инфекции появляется все большее число дискордантных пар, в которых один из половых партнеров является ВИЧ-позитивным. Это позволило идентифицировать и наблюдать в течение 2 лет 329 дискордантных пар, имеющих стабильные отношения. За период наблюдения в данной группе выявлен 21 случай инфицирования ВИЧ, показатель заболеваемости составил 6,4%.

Выявлен более низкий показатель заболеваемости ВИЧ-инфекцией в дискордантных парах (постоянные партнеры) в сравнении с гетеросексуальными половыми партнерами ВИЧ-инфицированных (постоянные и случайные) Одно из наиболее вероятных объяснений состоит в том, что ВИЧ-отрицательный партнер в дискордантной паре информирован о ВИЧ-позитивности другого партнера, что способствует использованию им средств защиты.

Полный текст нетрудно найти в сети.

Еще можно почитать тут: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2748905/



Q: Без выделения возбудителя в чистом виде постулаты Коха не выполняются и ВИЧ нельзя считать заболеванием инфекционной этиологии.

Цитата (википедия):
1. Микроорганизм постоянно встречается в организме больных людей (или животных) и отсутствует у здоровых;
2. Микроорганизм должен быть изолирован от больного человека или животного и его штамм должен быть выращен в чистой культуре;
3. При заражении чистой культурой микроорганизма здоровый человек (или животное) заболевает;
4. Микроорганизм должен быть повторно изолирован от экспериментально заражённого животного или человека.

A: Первые три постулата известны также под названием триады Коха. Следует заметить, что Кох полностью изъял вторую часть первого постулата, обнаружив бессимптомных носителей холеры (Koch, 1893) и, позже, тифа. Второй постулат не всегда удается реализовать для доказательства патогенной природы микроорганизма, так как все вирусы и некоторые бактерии (например. возбудители проказы) не могут быть получены в чистой культуре на искусственной питательной среде.

Третий постулат не всегда имеет место, как это обнаружил сам Кох для туберкулёза и для холеры (Koch, 1884). Нередко у части индивидов подверженного инфекционному заболеванию вида существует врожденная или приобретенная невосприимчивость, связанная с иммунным статусом или особенностями генотипа. Например, люди с делецией части гена CCR5 (гомозиготы по аллелю CCR5 Δ32) не заражаются ВИЧ-инфекцией, натуральной оспой и чумой.

Говоря проще, есть куча заболеваний, официально признанных, не подходящих под постулаты Коха.




Q: Никто и никогда не видел ВИЧ. Нет ни одной фотографии ВИЧ.

A: Ответ 1. Этот аргумент противоречит всей истории исследования ВИЧ и СПИДа. ВИЧ был открыт в 1983. В том же 1983 было показано, что добавление ВИЧ в культуру CD4 лимфоцитов приводило к гибели этих клеток in vitro . В 1984 обнаружены антитела к ВИЧ а сам вирус удалось клонировать.

В 1985 секвенирован геном ВИЧ Однако, как позднее свидетельствовал сам Роберт Галло: «Мы так и не нашли ВИЧ в Т-лимфоцитах» (New York Native, 13 июня 1994 г.). Кроме того, доктор Элени Пападопулос-Элиопулос указала на серьёзные погрешности при выявлении ретровируса. В журнале «Континуум» она заявила, что электронные микрофотоснимки ретровируса являются фотографиями неочищенных клеточных культур, что представляет собой грубое нарушение норм выявления ретровирусов (рассматриваемых только в градиенте плотности). В 1986 открыт родственный вирус, получивший название ВИЧ-2. К середине 90-х годов были открыты родственные ВИЧ вирусы у животных, и подробно изучен цикл жизни ВИЧ. Кроме того, в 90-х годах путём объединения частей генома ВИЧ и родственных ему вирусов удалось создать несколько линий химерных вирусов. К 2000 году созданы детальные трёхмерные модели основных белков ВИЧ. Наконец в 2002 нескольким учёным, использовавшим новые способы окрашивания, удалось заснять перемещение ВИЧ в цитоплазме инфицированной клетки и его продвижение к ядру . Кроме того, в 2009 году с помощью 3D видеомикроскопии был детально изучен процесс распространения флуоресцентных клонов ВИЧ в популяции Т-лимфоцитов.

В свете этих достижений необходимость выделения ВИЧ по стандартизованной технологии 70-х годов XX века, на которой настаивают Елена Пападопулос-Елеопулос и некоторые другие диссиденты, неочевидна.

Следует отметить, что большинство диссидентов признают выделение и существование ВИЧ.

Ответ 2.www.youtube.com/watch?v=1wTCYnWYsCQ
Ответ 3.https://www.msu.edu/~luckie/paris/290B/Montagnier.pdf Там есть фотографии вирусных частиц.
Ответ 4. Cryo-Electron Tomographic Structure of an Immunodeficiency Virus Envelope Complex In Situ
Giulia Zanetti, John A. G Briggs,Kay Grьnewald, Quentin J Sattentau and Stephen D Fuller

Ответ 5. Ну и напоследок для тех, кому еще интересно - съёмки вируса электронным микроскопом.
На всякий случай сообщу, что FEI Tecnai Spirit Transmission Electron Microscope (TEM) - это такой электронный микроскоп. Прочитать подробнее можно тут www.fei.com/products/transmission-electron-microscopes/tecnai.aspx, дабы не было сомнений, что это и правда микроскоп, а не что-то там еще. FEI - это ведущая компания по производству электронных приборов для различных отраслей науки. Данная съемка сделана их прибором и выложена от имени компании (в этом можно убедиться, открыв канал пользователя FEICompany). Надеюсь, это положит конец диспутам о том, что фото вируса не существует.

А собственно съемка тут: http://youtube.com/watch?v=OeWHYXzOzoA


UpDt: Хочу дать линк на хорошую статью на эту же тему.
Цитата: Представьте себе, что вы – механик. Вы отлично знаете как устроен автомобиль, где у него мотор, какой используется бензин. Более того, вы знаете такие детали, как тип резины на покрышках и даже цвет коврика под ногами. Вдруг кто-то заявляет, что автомобилей не существуют, что их выдумали нефтяные корпорации, чтобы люди покупали бензин. Ощущения биолога, которому сказали, что ВИЧ не существует, аналогичны.

  • 1
Здравствуйте. Большое спасибо за ваш журнал, здесь столько полезного и интересного:) Извините, если мой вопрос дилетантский - как Вы думаете, каковы мотивы СПИД-диссидентов, научные заблуждения исключим, утверждать, что ВИЧ не существует или, по крайней мере, он совершенно безобиден? Например, в масштабах государства: раз ВИЧ нет, то и финансирование на антиретровирусную терапию, профилактику, работы СПИД-центров, научные исследования выделять не нужно, что абсолютно логично - зачем проплачивать то, чего нет. Мне очень бы хотелось услышать ваше мнение, если Вас, конечно, не затруднит. Спасибо.

Добрый день! Спасибо Вам за отзыв, мне приятно и важно, что мой блог кто-то читает и находит его полезным. На самом деле, наверное, уменьшение числа постов в последнее время связано именно с тем, что у меня возник вопрос: а нужно ли это все кому-то, кроме меня? Т.к. время и сил это требует немало, от необходимости самовыражения подобным образом я уже отошел, а нужность моих постов под вопросом :)

Ваш вопрос о причинах возникновения СПИД-диссиденства очень интересный, я сам периодически его себе задаю. Попробую поразмышлять вслух. Диссидентов-ученых исчезающе мало. Фигурирует всего пара фамилий, причем ссылки идут к словам этих людей многолетней давности. Оставим их в стороне. Подавляющее число диссидентов и диссидентами-то назвать нельзя, т.к. это полные дилетанты в теме ВИЧ и все их "диссиденство" это просто увлечение теориями всемирного заговора. Они просто прочитали одну из многих псевдонаучных статеек на эту тему, и стали наивно полагать, что теперь-то они знают "страшную правду". Причем я не утверждаю, что всемирных заговоров не существует вообще, и лишь против того, чтобы вместе с водой выплескивать и младенца. "Экономическое диссиденство" в государственных масштабах для экономии средств вряд ли возможно, т.к. невозможно только по этой причине противоречить соверенно очевидным и распространенным научным фактам. Остается довольно узкий класс диссидентов, которые не будучи учеными-врачами, все-таки достаточно подробно разобрались в теме ВИЧ, вирусологии, иммунологии и смежных направлениях. Именно для них и предназначен этот пост, т.к. он отвечает на все их вопросы с достаточной степенью детализации и ухода в научные и медицинские тонкости. Ну вот, кажется спектр диссидентов исчерпан, или я что-то упустил? :))

Спасибо, Вы дали развернутый ответ. Казалось бы ВИЧу не один год, а поди ж ты - до сих пор разбираются существует он или нет. Благодарю за ответ:) Если будет возможность - не забрасывайте журнал, думаю, его многие читают.

Да в том то и дело, что разбираются в этом лишь весьма далекие от этой темы люди. Но в силу популярности темы СПИДа вообще, все это приобрело такой масштаб в Сети и уже вышло за ее пределы.

Нужно, очень.
Спасибо вам большое!

Здравствуйте, извините, вопрос не совсем по теме, но поскольку у вас обширные познания в области ВИЧ/СПИДа спрошу именно вас. Возможна ли передача ВИЧ при использовании презерватива? Большинство говорят, что нет. Но недавно мне попалась статейка в сети о том, что в латексе есть микропоры и ко всему этому прилагалась видеозапись эксперимента - в презерватив налили окрашенную воду, положили на лист белой бумаги, которая через некоторый промежуток времени промокла. Я понимаю, мой вопрос похож на бред, но для меня это очень серьезно, мой любимый человек ВИЧ+ и он, как ни странно, разделяет эту точку зрения. Конечно, нельзя верить всему, что пишут в интернете - тут пишут все кому не лень, подчас люди мало что понимающие, а порой и просто неадекватные. Но ведь эти заявления тоже откуда-то берутся, дыма без огня не бывает. Заранее большое спасибо:)

Добрый вечер. Ваш вопрос совсем не бредовый, так что не стоит так уж себя уничижать. Если не вдаваться в разные технические и физические тонкости, то ответ простой: никаких пор в латексе нет и презерватив, если он не рвется и не соскакивает во время контакта, надежно защищает от ВИЧ. Поэтому именно на это вам в вашей ситуации нужно обратить внимание - правильно использовать качественные презервативы, чтобы свести риск их повреждения к нулю. К сожалению, дым без огня тоже иногда бывает :))) Если у Вас будут еще вопросы - пишите, постараюсь ответить.

Спасибо вам огромное:)Если у меня появятся вопросы, задам, но если так случится и я чересчур увлекусь, отнимая ваше время и силы - вы, пожалуйста, скажите:) Доброй ночи.

Пожалуйста! Всегда буду рад поделиться своим опытом и знаниями. Пишите! :)

  • 1